OR2K2
OR2K2 Gene Cloning Plasmid for Molecular Biology Research
OR2K2 Gene Plasmid
CAT#: 0399-CSB-CL844071HU
Size: 10 μg Plasmid + 200 μL Glycerol
Dry Ice: No
Hazardous: No
Gene Target: OR2K2
Sequence Length: 951 bp
24/48H Stock Items & 2 to 6 Weeks non Stock Items.
Product Description
OR2K2 is a gene belonging to the olfactory receptor family, a group of genes encoding proteins involved in the detection of odorant molecules. Olfactory receptors are members of the G protein-coupled receptor (GPCR) superfamily and play an important role in olfactory signal transduction.
This OR2K2 gene cloning plasmid is supplied as 10 μg of plasmid DNA with 200 μL glycerol. It is intended for molecular biology research involving gene cloning, DNA analysis and studies of olfactory receptor genes.
Key Features
- Target gene: OR2K2
- Plasmid DNA supplied with glycerol
- Plasmid quantity: 10 μg
- Glycerol volume: 200 μL
- Sequence length: 951 bp
- Suitable for gene cloning and molecular biology research
Research Applications
- Gene cloning and DNA manipulation
- Olfactory receptor gene research
- Molecular biology and genetic studies
- Plasmid DNA analysis
- Investigation of GPCR-related biological pathways
Technical Specifications
| Product Name | OR2K2 |
| Catalog Number | 0399-CSB-CL844071HU |
| Gene Symbol | OR2K2 |
| Product Type | Gene Cloning Plasmid |
| Plasmid Quantity | 10 μg |
| Glycerol Volume | 200 μL |
| Sequence Length | 951 bp |
| Dry Ice | No |
| Hazardous | No |
Nucleotide Sequence
The supplied OR2K2 nucleotide sequence is 951 base pairs in length. Expand the section below to view the complete sequence.
View Complete OR2K2 DNA Sequence (951 bp)
ATGCAAGGAGAAAACTTCACCATTTGGAGCATTTTTTTCTTGGAGGGATTTTCCCAGTACCCAGGGTTAGAAGTGGTTCTCTTCGTCTTCAGCCTTGTAATGTATCTGACAACGCTCTTGGGCAACAGCACTCTTATTTTGATCACTATCCTAGATTCACGCCTTAAAACCCCCATGTACTTATTCCTTGGAAATCTCTCTTTCATGGATATTTGTTACACATCTGCCTCTGTTCCTACTTTGCTGGTGAACTTGCTGTCATCCCAGAAAACCATTATCTTTTCTGGGTGTGCTGTACAGATGTATCTGTCCCTTGCCATGGGCTCCACAGAGTGTGTGCTCCTGGCCGTGATGGCATATGACCGTTATGTGGCCATTTGTAACCCGCTGAGATACTCCATCATCATGAACAGGTGCGTCTGTGCACGGATGGCTACGGTCTCCTGGGTGACGGGTTGCCTGACCGCTCTGCTGGAAACCAGTTTTGCCCTGCAGATACCCCTCTGTGGGAATCTCATCGATCACTTCACGTGTGAAATTCTGGCGGTGCTAAAGTTAGCTTGCACAAGTTCACTGCTCATGAACACCATCATGCTGGTGGTCAGCATTCTCCTCTTGCCAATTCCAATGCTCTTAGTTTGCATCTCTTACATCTTCATCCTTTCCACTATTCTGAGAATCACCTCAGCAGAGGGAAGAAACAAGGCTTTTTCTACCTGTGGTGCCCATTTGACTGTGGTGATTTTGTATTATGGGGCTGCCCTCTCTATGTACCTAAAGCCTTCTTCATCAAATGCACAAAAAATAGACAAAATCATCTCGTTGCTTTACGGAGTGCTTACCCCTATGTTGAACCCCATAATTTACAGTTTAAGAAACAAGGAAGTCAAAGATGCTATGAAGAAATTGCTGGGCAAAATAACATTGCATCAAACACACGAACATCTCTGA